Review



stat1 primer pair  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 92
      Buy from Supplier

    Structured Review

    OriGene stat1 primer pair
    HO-1 inhibition disrupts the <t>STAT1</t> signaling pathway. qRT-PCR analysis in LNCaP cells confirmed the higher expression level of STAT1 gene with the 24 h Doc (10 nM) treatment compared to untreated control cells (A) . MTT assay following a 48 h treatment showed that using Fluda (15 µM), a STAT1 specific inhibitor, significantly decreased PC cell survival when combined with either Doc (10 nM) or ZnPP (5 µM) in LNCaP cells under normoxia (B) , and in DU145 cells under both normoxic and hypoxic conditions (C, D) . qRT-PCR analysis revealed a significant decrease in HMOX-1 gene expression levels after 24 h treatment with Fluda (25 µM), alone or in combination with Doc (10 nM), in DU145 cells (E) . (n=3, **** = P<0.0001, *** = P<0.0001, * = P<0.05).
    Stat1 Primer Pair, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/STAT1+Human+qPCR+Primer+Pair/pmc11291216-85-19-29
    Average 92 stars, based on 4 article reviews
    stat1 primer pair - by Bioz Stars, 2026-10
    92/100 stars

    Images

    1) Product Images from "Targeting heme degradation pathway augments prostate cancer cell sensitivity to docetaxel-induced apoptosis and attenuates migration"

    Article Title: Targeting heme degradation pathway augments prostate cancer cell sensitivity to docetaxel-induced apoptosis and attenuates migration

    Journal: Frontiers in Oncology

    doi: 10.3389/fonc.2024.1431362

    HO-1 inhibition disrupts the STAT1 signaling pathway. qRT-PCR analysis in LNCaP cells confirmed the higher expression level of STAT1 gene with the 24 h Doc (10 nM) treatment compared to untreated control cells (A) . MTT assay following a 48 h treatment showed that using Fluda (15 µM), a STAT1 specific inhibitor, significantly decreased PC cell survival when combined with either Doc (10 nM) or ZnPP (5 µM) in LNCaP cells under normoxia (B) , and in DU145 cells under both normoxic and hypoxic conditions (C, D) . qRT-PCR analysis revealed a significant decrease in HMOX-1 gene expression levels after 24 h treatment with Fluda (25 µM), alone or in combination with Doc (10 nM), in DU145 cells (E) . (n=3, **** = P<0.0001, *** = P<0.0001, * = P<0.05).
    Figure Legend Snippet: HO-1 inhibition disrupts the STAT1 signaling pathway. qRT-PCR analysis in LNCaP cells confirmed the higher expression level of STAT1 gene with the 24 h Doc (10 nM) treatment compared to untreated control cells (A) . MTT assay following a 48 h treatment showed that using Fluda (15 µM), a STAT1 specific inhibitor, significantly decreased PC cell survival when combined with either Doc (10 nM) or ZnPP (5 µM) in LNCaP cells under normoxia (B) , and in DU145 cells under both normoxic and hypoxic conditions (C, D) . qRT-PCR analysis revealed a significant decrease in HMOX-1 gene expression levels after 24 h treatment with Fluda (25 µM), alone or in combination with Doc (10 nM), in DU145 cells (E) . (n=3, **** = P<0.0001, *** = P<0.0001, * = P<0.05).

    Techniques Used: Inhibition, Quantitative RT-PCR, Expressing, Control, MTT Assay, Gene Expression

    Related Articles

    Expressing:

    Article Title: Epstein-Barr Virus Promotes Tumorigenicity and Worsens Hodgkin Lymphoma Prognosis by Activating JAK/STAT and NF-κB Signaling Pathways
    Article Snippet: .. The expression levels of target genes were then estimated using the 2 −ΔΔCT method., Primers STAT1 (#HP210040), JAK2 (#HP208201), IRF-1 (HP205934), PD-L1 (#HP210654), IFN-γ (#HP200586), NF-κB (#HP207409), Bcl-xL (#HP234144), COX-2 (#HP200900), GAPDH (#HP205798), and β-catenin (#KN208947) were purchased from OriGene Technologies (Beijing, China). ..



    Similar Products

    primers of p-stat1, p-stat3, p-p65, p-tbk1, and p-irf3  (Thermo Fisher)
    90
    Thermo Fisher primers of p-stat1, p-stat3, p-p65, p-tbk1, and p-irf3
    Primers Of P Stat1, P Stat3, P P65, P Tbk1, And P Irf3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/anti+stat1+antibody+aho0832/pmc11837995-219-25-31
    Average 90 stars, based on 1 article reviews
    primers of p-stat1, p-stat3, p-p65, p-tbk1, and p-irf3 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    qpcr primers antibody species source id application wb xdilution if if xdilution chip if xdilution chip xdilution stat1α  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology qpcr primers antibody species source id application wb xdilution if if xdilution chip if xdilution chip xdilution stat1α
    Qpcr Primers Antibody Species Source Id Application Wb Xdilution If If Xdilution Chip If Xdilution Chip Xdilution Stat1α, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/Stat1+Antibody/pmc12378792__42003_2025_8740_MOESM2_ESM-52-4-21
    Average 96 stars, based on 1 article reviews
    qpcr primers antibody species source id application wb xdilution if if xdilution chip if xdilution chip xdilution stat1α - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    stat1 (mm_stat1_2_sg quantitect primer assay, qt01149519)  (Qiagen)
    90
    Qiagen stat1 (mm_stat1_2_sg quantitect primer assay, qt01149519)
    Stat1 (Mm Stat1 2 Sg Quantitect Primer Assay, Qt01149519), supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/stat1+sirna/pm40025196-111-7-2
    Average 90 stars, based on 1 article reviews
    stat1 (mm_stat1_2_sg quantitect primer assay, qt01149519) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    primers for quantification of human pd-l1, il-8, bcl3, stat1, and actin mrna  (Qiagen)
    90
    Qiagen primers for quantification of human pd-l1, il-8, bcl3, stat1, and actin mrna
    Primers For Quantification Of Human Pd L1, Il 8, Bcl3, Stat1, And Actin Mrna, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/mmp+9++qt00040040+/pm39988077-125-1-15
    Average 90 stars, based on 1 article reviews
    primers for quantification of human pd-l1, il-8, bcl3, stat1, and actin mrna - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    stat1 primer pair  (OriGene)
    92
    OriGene stat1 primer pair
    HO-1 inhibition disrupts the <t>STAT1</t> signaling pathway. qRT-PCR analysis in LNCaP cells confirmed the higher expression level of STAT1 gene with the 24 h Doc (10 nM) treatment compared to untreated control cells (A) . MTT assay following a 48 h treatment showed that using Fluda (15 µM), a STAT1 specific inhibitor, significantly decreased PC cell survival when combined with either Doc (10 nM) or ZnPP (5 µM) in LNCaP cells under normoxia (B) , and in DU145 cells under both normoxic and hypoxic conditions (C, D) . qRT-PCR analysis revealed a significant decrease in HMOX-1 gene expression levels after 24 h treatment with Fluda (25 µM), alone or in combination with Doc (10 nM), in DU145 cells (E) . (n=3, **** = P<0.0001, *** = P<0.0001, * = P<0.05).
    Stat1 Primer Pair, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/STAT1+Human+qPCR+Primer+Pair/pmc11291216-85-19-29
    Average 92 stars, based on 1 article reviews
    stat1 primer pair - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    ccaaaccaggctggcacaattg  (OriGene)
    92
    OriGene ccaaaccaggctggcacaattg
    HO-1 inhibition disrupts the <t>STAT1</t> signaling pathway. qRT-PCR analysis in LNCaP cells confirmed the higher expression level of STAT1 gene with the 24 h Doc (10 nM) treatment compared to untreated control cells (A) . MTT assay following a 48 h treatment showed that using Fluda (15 µM), a STAT1 specific inhibitor, significantly decreased PC cell survival when combined with either Doc (10 nM) or ZnPP (5 µM) in LNCaP cells under normoxia (B) , and in DU145 cells under both normoxic and hypoxic conditions (C, D) . qRT-PCR analysis revealed a significant decrease in HMOX-1 gene expression levels after 24 h treatment with Fluda (25 µM), alone or in combination with Doc (10 nM), in DU145 cells (E) . (n=3, **** = P<0.0001, *** = P<0.0001, * = P<0.05).
    Ccaaaccaggctggcacaattg, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/STAT1+Human+qPCR+Primer+Pair/pmc11291216-85-28-29
    Average 92 stars, based on 1 article reviews
    ccaaaccaggctggcacaattg - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    stat1 qpcr primer pair qm05278s  (Beyotime)
    90
    Beyotime stat1 qpcr primer pair qm05278s
    HO-1 inhibition disrupts the <t>STAT1</t> signaling pathway. qRT-PCR analysis in LNCaP cells confirmed the higher expression level of STAT1 gene with the 24 h Doc (10 nM) treatment compared to untreated control cells (A) . MTT assay following a 48 h treatment showed that using Fluda (15 µM), a STAT1 specific inhibitor, significantly decreased PC cell survival when combined with either Doc (10 nM) or ZnPP (5 µM) in LNCaP cells under normoxia (B) , and in DU145 cells under both normoxic and hypoxic conditions (C, D) . qRT-PCR analysis revealed a significant decrease in HMOX-1 gene expression levels after 24 h treatment with Fluda (25 µM), alone or in combination with Doc (10 nM), in DU145 cells (E) . (n=3, **** = P<0.0001, *** = P<0.0001, * = P<0.05).
    Stat1 Qpcr Primer Pair Qm05278s, supplied by Beyotime, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/activator+transcription+1++stat1/pmc11268468__SC___015___D4SC03629H___s001-87-0-8
    Average 90 stars, based on 1 article reviews
    stat1 qpcr primer pair qm05278s - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    gene-specific pcr individual primer human stat1, il-1в  (Qiagen)
    90
    Qiagen gene-specific pcr individual primer human stat1, il-1в
    HO-1 inhibition disrupts the <t>STAT1</t> signaling pathway. qRT-PCR analysis in LNCaP cells confirmed the higher expression level of STAT1 gene with the 24 h Doc (10 nM) treatment compared to untreated control cells (A) . MTT assay following a 48 h treatment showed that using Fluda (15 µM), a STAT1 specific inhibitor, significantly decreased PC cell survival when combined with either Doc (10 nM) or ZnPP (5 µM) in LNCaP cells under normoxia (B) , and in DU145 cells under both normoxic and hypoxic conditions (C, D) . qRT-PCR analysis revealed a significant decrease in HMOX-1 gene expression levels after 24 h treatment with Fluda (25 µM), alone or in combination with Doc (10 nM), in DU145 cells (E) . (n=3, **** = P<0.0001, *** = P<0.0001, * = P<0.05).
    Gene Specific Pcr Individual Primer Human Stat1, Il 1в, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/stat1+sirna/pm38692204-72-16-18
    Average 90 stars, based on 1 article reviews
    gene-specific pcr individual primer human stat1, il-1в - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    δδct method  (OriGene)
    92
    OriGene δδct method
    HO-1 inhibition disrupts the <t>STAT1</t> signaling pathway. qRT-PCR analysis in LNCaP cells confirmed the higher expression level of STAT1 gene with the 24 h Doc (10 nM) treatment compared to untreated control cells (A) . MTT assay following a 48 h treatment showed that using Fluda (15 µM), a STAT1 specific inhibitor, significantly decreased PC cell survival when combined with either Doc (10 nM) or ZnPP (5 µM) in LNCaP cells under normoxia (B) , and in DU145 cells under both normoxic and hypoxic conditions (C, D) . qRT-PCR analysis revealed a significant decrease in HMOX-1 gene expression levels after 24 h treatment with Fluda (25 µM), alone or in combination with Doc (10 nM), in DU145 cells (E) . (n=3, **** = P<0.0001, *** = P<0.0001, * = P<0.05).
    δδct Method, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/STAT1+Human+qPCR+Primer+Pair/pmc10862106-183-12-39
    Average 92 stars, based on 1 article reviews
    δδct method - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    primers stat1  (OriGene)
    92
    OriGene primers stat1
    The sequence of primers used for the real-time polymerase chain reaction
    Primers Stat1, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primers+stat1/STAT1+Human+qPCR+Primer+Pair/pmc10862106-183-14-39
    Average 92 stars, based on 1 article reviews
    primers stat1 - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier

    Image Search Results


    HO-1 inhibition disrupts the STAT1 signaling pathway. qRT-PCR analysis in LNCaP cells confirmed the higher expression level of STAT1 gene with the 24 h Doc (10 nM) treatment compared to untreated control cells (A) . MTT assay following a 48 h treatment showed that using Fluda (15 µM), a STAT1 specific inhibitor, significantly decreased PC cell survival when combined with either Doc (10 nM) or ZnPP (5 µM) in LNCaP cells under normoxia (B) , and in DU145 cells under both normoxic and hypoxic conditions (C, D) . qRT-PCR analysis revealed a significant decrease in HMOX-1 gene expression levels after 24 h treatment with Fluda (25 µM), alone or in combination with Doc (10 nM), in DU145 cells (E) . (n=3, **** = P<0.0001, *** = P<0.0001, * = P<0.05).

    Journal: Frontiers in Oncology

    Article Title: Targeting heme degradation pathway augments prostate cancer cell sensitivity to docetaxel-induced apoptosis and attenuates migration

    doi: 10.3389/fonc.2024.1431362

    Figure Lengend Snippet: HO-1 inhibition disrupts the STAT1 signaling pathway. qRT-PCR analysis in LNCaP cells confirmed the higher expression level of STAT1 gene with the 24 h Doc (10 nM) treatment compared to untreated control cells (A) . MTT assay following a 48 h treatment showed that using Fluda (15 µM), a STAT1 specific inhibitor, significantly decreased PC cell survival when combined with either Doc (10 nM) or ZnPP (5 µM) in LNCaP cells under normoxia (B) , and in DU145 cells under both normoxic and hypoxic conditions (C, D) . qRT-PCR analysis revealed a significant decrease in HMOX-1 gene expression levels after 24 h treatment with Fluda (25 µM), alone or in combination with Doc (10 nM), in DU145 cells (E) . (n=3, **** = P<0.0001, *** = P<0.0001, * = P<0.05).

    Article Snippet: HMOX-1 mRNA primer pair used is F: CCAGGCAGAGAATGCTGAGTTC and R: AAGACTGGGCTCTCCTTGTTGC (OriGene, Rockville, MD, USA, Cat# HP205872), and the STAT1 primer pair used is F: ATGGCAGTCTGGCGGCTGAATT and R: CCAAACCAGGCTGGCACAATTG (OriGene, Rockville, MD, USA, Cat# HP210040).

    Techniques: Inhibition, Quantitative RT-PCR, Expressing, Control, MTT Assay, Gene Expression

    The sequence of primers used for the real-time polymerase chain reaction

    Journal: Iranian Journal of Medical Sciences

    Article Title: Epstein-Barr Virus Promotes Tumorigenicity and Worsens Hodgkin Lymphoma Prognosis by Activating JAK/STAT and NF-κB Signaling Pathways

    doi: 10.30476/IJMS.2023.97287.2896

    Figure Lengend Snippet: The sequence of primers used for the real-time polymerase chain reaction

    Article Snippet: The expression levels of target genes were then estimated using the 2 −ΔΔCT method., Primers STAT1 (#HP210040), JAK2 (#HP208201), IRF-1 (HP205934), PD-L1 (#HP210654), IFN-γ (#HP200586), NF-κB (#HP207409), Bcl-xL (#HP234144), COX-2 (#HP200900), GAPDH (#HP205798), and β-catenin (#KN208947) were purchased from OriGene Technologies (Beijing, China).

    Techniques: Sequencing

    The mRNA expression of JAK2/STAT1 and NF-κB signaling pathways in patients with EBV-positive and EBV-negative Hodgkin lymphoma

    Journal: Iranian Journal of Medical Sciences

    Article Title: Epstein-Barr Virus Promotes Tumorigenicity and Worsens Hodgkin Lymphoma Prognosis by Activating JAK/STAT and NF-κB Signaling Pathways

    doi: 10.30476/IJMS.2023.97287.2896

    Figure Lengend Snippet: The mRNA expression of JAK2/STAT1 and NF-κB signaling pathways in patients with EBV-positive and EBV-negative Hodgkin lymphoma

    Article Snippet: The expression levels of target genes were then estimated using the 2 −ΔΔCT method., Primers STAT1 (#HP210040), JAK2 (#HP208201), IRF-1 (HP205934), PD-L1 (#HP210654), IFN-γ (#HP200586), NF-κB (#HP207409), Bcl-xL (#HP234144), COX-2 (#HP200900), GAPDH (#HP205798), and β-catenin (#KN208947) were purchased from OriGene Technologies (Beijing, China).

    Techniques: Expressing, Protein-Protein interactions